Skip to content

Question about motif identification #1

New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Open
yifnzhao opened this issue Oct 18, 2021 · 1 comment
Open

Question about motif identification #1

yifnzhao opened this issue Oct 18, 2021 · 1 comment

Comments

@yifnzhao
Copy link

Hi, thanks for developing this great tool! I have a question about how the motifs are identified. In the example below, I am wondering why longer motifs, such as TCCCCTCCCACCCGG are not identified. In fact, when min_motif_size is set to >4, no vntrs were detected by VNTRMiner in this sequence.

name='6:168377992-168378192'
seq='CTCCCCCCTCCCACACCGGAGCCTTCTCTCCCCTCCCACCCGGGACCTCTTCTCCCCTCCCACCCGGGGCCTCCTCTCCCCTCCCACCCGGGACCTCTTCTCCCCCCCATCCGGGGCCTGCTGTCCCCTCCCACCCGGGACCTCTTCTCCCCTCCCATCCGGGGCCTCCTCTCCCCTCCCACCCGGGACCTCTTCTCCCCT'
for vntr in stria.VNTRMiner(name, seq, min_motif_size=4):
    print(vntr.as_dict())

>>> {'chrom': '6:168377992-168378192', 'start': 28, 'end': 37, 'motif': 'CTCCC', 'type': 5, 'repeats': 2, 'length': 10}
{'chrom': '6:168377992-168378192', 'start': 52, 'end': 61, 'motif': 'CTCCC', 'type': 5, 'repeats': 2, 'length': 10}
{'chrom': '6:168377992-168378192', 'start': 76, 'end': 85, 'motif': 'CTCCC', 'type': 5, 'repeats': 2, 'length': 10}
{'chrom': '6:168377992-168378192', 'start': 147, 'end': 156, 'motif': 'CTCCC', 'type': 5, 'repeats': 2, 'length': 10}
{'chrom': '6:168377992-168378192', 'start': 171, 'end': 180, 'motif': 'CTCCC', 'type': 5, 'repeats': 2, 'length': 10}
@lmdu
Copy link
Owner

lmdu commented Jul 15, 2024

fixed in v1.3.1

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
None yet
Projects
None yet
Development

No branches or pull requests

2 participants