Skip to content
 
 

Latest commit

 

History

358 Commits

Folders and files

NameName
Last commit message
Last commit date
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Table of Contents

SingleM

Welcome.

SingleM is a tool to find the abundances of discrete operational taxonomic units (OTUs) directly from shotgun metagenome data, without heavy reliance on reference sequence databases. It is able to differentiate closely related species even if those species are from lineages new to science.

Where GraftM can give a taxonomic overview of your community e.g. proportion of a community from a particular taxonomic family, SingleM finds sequence-based OTUs from raw, untrimmed metagenomic reads.

This gives you the ability to answer questions such as:

  • How many different kinds of TM6 do I have?
  • What is the Chao 1 diversity of my sample?
  • Are the Acidobacteria in sample 1 very closely related to the Acidobacteria in sample 2?
  • Do I have population genomes for the main community members?
  • How diverse are the Pelagibacteria relative to the Flavobacteria?
  • Has my genome been observed in any samples submitted to the SRA?
  • Which community members are more likely to assemble?

Generating an OTU table

An overview of your community can be obtained like so:

singlem pipe --sequences my_sequences.fastq.gz --otu_table otu_table.csv --threads 24

Please use raw metagenome reads, not quality trimmed reads. Quality trimming with e.g. Trimmomatic reads often makes them too short for SingleM to use. On the other hand, adapter trimming is unlikely to be detrimental.

The output table consists of columns:

gene    sample  sequence        num_hits        coverage        taxonomy
4.21.ribosomal_protein_S19_rpsS my_sequences  TGGTCGCGCCGTTCGACGGTCACTCCGGACTTCATCGGCCTACAGTTCGCCGTGCACATC    1       1.64    Root; d__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Desulfuromonadales
4.21.ribosomal_protein_S19_rpsS my_sequences  TGGTCGCGGCGCTCAACCATTCTGCCCGAGTTCGTCGGCCACACCGTGGCCGTTCACAAC    1       1.64    Root; d__Bacteria; p__Acidobacteria; c__Solibacteres; o__Solibacterales; f__Solibacteraceae; g__Candidatus_Solibacter; s__Candidatus_Solibacter_usitatus
  1. marker name
  2. sample name
  3. sequence of the OTU
  4. number of reads detected from that OTU
  5. estimated coverage of a genome from this OTU
  6. "median" taxonomic classification of each of the reads in the OTU according to pplacer

Currently SingleM concentrates on 15 single copy marker genes to provide fine-grained differentiation of species that is independent of the copy-number variation issues that hamper 16S analyses. SingleM is reasonably fast and is quite scalable, although there is much room for improvement. On average, each of the 15 genes better differentiates closely related lineages than a typical 16S amplicon-based study.

Further processing of OTU tables

Summarising OTU tables

Once an OTU table has been generated with the pipe command, it can be further processed in various ways using summarise:

Create a Krona plot of the community. The following command generates my_krona*.html files which can be viewed in a web browser:

singlem summarise --input_otu_table otu_table.csv --krona my_krona

Cluster sequences, collapsing them into OTUs with less resolution, but with more robustness against sequencing error:

singlem summarise --input_otu_table otu_table.csv --cluster --clustered_output_otu_table clustered.otu_table.csv

Rarefy a set of OTU tables so that each sample contains the same number of OTU sequences:

singlem summarise --input_otu_tables otu_table.csv other_samples.otu_table.csv --rarefied_output_otu_table rarefied.otu_table.csv --number_to_choose 100

Conversion to BIOM format for use with QIIME:

singlem summarise --input_otu_tables otu_table.csv other_samples.otu_table.csv --biom_prefix myprefix

This generates a BIOM table for each marker gene e.g. myprefix.4.12.ribosomal_protein_L11_rplK.biom.

Calculating beta diversity between samples

As SingleM generates OTUs that are independent of taxonomy, they can be used as input to beta diversity methods known to be appropriate for the analysis of 16S amplicon studies, of which there are many. We recommend express beta diversity (EBD) as it implements many different metrics with a unified interface. For instance to calculate Bray-Curtis beta diversity, first convert your OTU table to unifrac format using singlem summarise:

singlem summarise --input_otu_table otu_table.csv --unifrac otu_table.unifrac

The above commands generates 15 different unifrac format files, one for each marker gene used in SingleM. At this point, you need to choose one table to proceed with. Hopefully, the choice matters little, but it might pay to use multiple tables and ensure that the results are consistent.

To calculate beta diversity, use the EBD script convertToEBD.py to convert the unifrac format into ebd format, and calculate the diversity metric:

convertToEBD.py otu_table.unifrac.4.12.ribosomal_protein_L11_rplK.unifrac otu_table.ebd
ExpressBetaDiversity -s otu_table.ebd -c Bray-Curtis

Phylogenetic tree-based methods of calculating beta diversity can also be calculated, but pipe must be used to generate a new OTU table using the diamond_example taxonomy assignment method so that each OTU is assigned to a single leaf in the tree:

singlem pipe --sequences my_sequences.fastq.gz --otu_table otu_table.diamond_example.csv --threads 24 --assignment_method diamond_example
singlem summarise --otu_tables otu_table.diamond_example.csv --unifrac otu_table.diamond_example.csv
convertToEBD.py otu_table.diamond_example.unifrac otu_table.diamond_example.ebd
ExpressBetaDiversity -s otu_table.diamond_example.ebd -c Bray-Curtis -t `singlem get_tree --marker_name 4.21.ribosomal_protein_S19_rpsS`

Creating and querying SingleM databases

It can be useful in some situations to search for sequences in OTU tables. For instance, you may ask "is the most abundant OTU or anything similar in samples B, C or D?" To answer this question make a SingleM database from sample B, C & D's OTU tables:

singlem makedb --otu_tables sample_B.csv sample_C.csv sample_D.csv --db_path sample_BCD.sdb

.sdb is the conventional file extension for SingleM databases. Then to query this database

singlem query --query_sequence TGGTCGCGGCGCTCAACCATTCTGCCCGAGTTCGTCGGCCACACCGTGGCCGTTCACAAC --db sample_BCD.sdb

Appraising assembly and genome recovery efforts

SingleM can be used to determine how much of a community is represented in an assembly or represented by a set of genomes.

The assessment is carried out by comparing the set of OTU sequences in the assembly/genomes to those found from the raw metagenome reads. A similar metric can be estimated by the fraction of reads mapping to either the assembly or the genome, but the approach here is more flexible and has several advantages:

  1. We can determine which specific lineages are missing
  2. We can match OTU sequences imperfectly, so we can e.g. make statements about whether a genus level representative genome has been recovered
  3. Since the metric assesses only single copy marker genes, the appraisal is on a per-cell basis, not per-read
  4. Some care must be taken, but we can prevent Eukaryotic DNA from skewing the estimate

To assess how well a set of sequences represent a metagenome, first run pipe on both the genomes and the raw reads, and then use appraise:

singlem pipe --sequences raw.fq.gz --otu_table metagenome.otu_table.csv
singlem pipe --sequences my_genomes/*.fasta --otu_table genomes.otu_table.csv
singlem appraise --metagenome_otu_tables metagenome.otu_table.csv --genome_otu_tables genomes.otu_table.csv

One may also accommodate some sequence differences, with --imperfect, or output OTU tables of those sequences that match and those that do not (see singlem appraise -h). Assessing assemblies is similar to assessing genomes, except that when assessing bins duplicate markers from the same genome are excluded as likely contamination.

An appraisal can also be represented visually, using appraise --plot:

Image of appraise

Each rectangle represents a single OTU sequence where its size represents its abundance (the number of reads that OTU represents in the metagenome). Colours represent 89% OTU clustering of these sequences (~genus level), with the taxonomy of the most common sequence written out. Here we see that highly abundant OTUs in SRR5040536 were assembled, but only 1 of the 3 abundant Gallionellales OTUs has an associated bin. As is common, the highest abundance lineages did not necessarily assemble and bin successfully. The marker 4.20.ribosomal_protein_S15P_S13e was chosen as the representative marker because it has a representative fraction of OTUs binned, assembled and unassembled.

Installation

Installation via GNU Guix

The most straightforward way of installing SingleM is to use the GNU Guix package which is part of the ACE Guix package collection. This method installs not just the Python libraries required but the compiled bioinformatics tools needed as well, except smafa. Once you have installed Guix, clone the ACE collection and install:

git clone https://github.com/Ecogenomics/ace-guix
GUIX_PACKAGE_PATH=ace-guix guix package --install singlem

Beyond installing GNU Guix, super-user privileges are not required for installation.

Installation via DockerHub

A docker image generated from the Guix package is available on DockerHub. After installing Docker, run the following, replacing [RELEASE_TAG] with a tag from https://hub.docker.com/r/wwood/singlem/tags:

docker pull wwood/singlem:[RELEASE_TAG]

If the sequence data to be analyzed is in the current working directory, SingleM can be used like so:

docker run -v `pwd`:`pwd` wwood/singlem:[RELEASE_TAG] pipe --sequences `pwd`/my.fastq.gz --otu_table `pwd`/my.otu_table.csv --threads 15

Installation via PyPI

To install the Python libraries required:

pip install graftm
pip install singlem

You may need super-user privileges.

SingleM also has the following non-Python dependencies:

Some dependencies of GraftM:

Help

If you have any questions or comments, send a message to the SupportM mailing list or raise a GitHib issue.

FAQ

Can you target the 16S rRNA gene instead of the default set of ribosomal proteins with SingleM?

Yes. By default, SingleM builds OTU tables from ribosomal protein genes rather than 16S because this in general gives more strain-level resolution due to redundancy in the genetic code. If you are really keen on using 16S, then you can use SingleM with a 16S SingleM package (spkg). There is a repository of auxiliary packages at https://github.com/wwood/singlem_extra_packages including a 16S package that is suitable for this purpose. The resolution won't be as high taxonomically, and there are issues around copy number variation, but it could be useful to use 16S for various reasons e.g. linking it to an amplicon study or using the GreenGenes taxonomy. For now there's no 16S spkg that gets installed by default, you have to use the --singlem_packages flag pointing to a separately downloaded package - see https://github.com/wwood/singlem_extra_packages/blob/master/README.md.

How should SingleM be run on multiple samples?

There are two ways. It is possible to specify multiple input files to the singlem pipe subcommand directly by space separating them. Alternatively singlem pipe can be run on each sample and OTU tables combined using singlem summarise. The results should be identical, though there are some performance trade-offs. For large numbers of samples (>100) it is probably preferable to run each sample individually or in smaller groups.

License

SingleM is written by Ben Woodcroft (@wwood) at the Australian Centre for Ecogenomics (UQ) and is licensed under GPL3 or later.

About

De-novo OTUs from shotgun metagenomes

Resources

Stars

0 stars

Watchers

1 watching

Forks

Releases

Packages

Contributors

Languages